This tutorial shows how to calculate DNA melting temperature (Tm) in Python using Biopython, installed using bioconda.
1. Background on DNA Melting Temperature (Tm)
DNA melting temperature (Tm) refers to the temperature at which the double-stranded DNA molecule dissociates into single strands. This process, known as DNA melting or denaturation, occurs when the hydrogen bonds between the complementary base pairs in the DNA molecule are broken.
The Tm of DNA is dependent on several factors, including the salt concentration, pH, and the composition of the DNA molecule itself. In general, DNA with a higher GC content (the proportion of guanine and cytosine bases in the DNA sequence) will have a higher Tm compared to DNA with a low GC content. This is because guanine and cytosine have three hydrogen bonds between them, while adenine and thymine have only two, resulting in stronger hydrogen bonds in the GC-rich DNA regions.
The Tm of DNA is a useful parameter in many biotechnology applications, such as the design of primers for polymerase chain reactions (PCR), the analysis of gene expression and epigenetic changes, and the determination of the stability of DNA-protein interactions.
2. Calculate DNA Melting Temperature
First, we need to install Biopython, which can be quickly done using bioconda as we show below:
$ conda install -c conda-forge biopython
Next, Biopython provides three methods to compute the melting temperature as described below by their definitions:
- Tm_Wallace: ‘Rule of thumb’
- Tm_GC: Empirical formulas based on GC content. Salt and mismatch corrections can be included.
- Tm_NN: Calculation based on nearest-neighbor thermodynamics. Several tables for DNA/DNA, DNA/RNA, and RNA/RNA hybridizations are included. Correction for mismatches, dangling ends, salt concentration, and other additives are available.
Now, there are three examples of how all the methods differ from each other
>>> from Bio.SeqUtils import MeltingTemp
>>> sequence = "TAGTGATGACTGTCGTAGCTGTCGTAGATGTGTCATAAAAAA"
# Rule of thumb melting temperature
>>> MeltingTemp.Tm_Wallace(sequence)
>>> 116.0
# GC melting temperature
>>> MeltingTemp.Tm_GC(sequence)
>>> 60.98
# nearest-neighbor melting temperature
>>> MeltingTemp.Tm_NN(sequence)
>>> 62.86
Last but not least, in case you want to learn more about the melting temperature Biopython methods, please check it out here.
3. More Resources
- Fast Conversion of Lowercase Sequences to Uppercase in FASTA Format
- Easy NCBI Genome Download
- The Fastest Way to Read a FASTA in Python



